Skip to main content

Table 1 The details of primer of β-actin and the target genes for RT-PCR

From: Electromagnetic radiation at 900 MHz induces sperm apoptosis through bcl-2, bax and caspase-3 signaling pathways in rats

Gene Primers(5′-3′) Product(bp)
β-actin F: CACGATGGAGGGGCCGGACTCATC 240
R: TAAAGACCTCTATGCCAACACAGT
bcl-2 F: GGTGAACTGGGGGAGGATTG 197
R: GCATGCTGGGGCCATATAGT
bax F: GGCGATGAACTGGACAACAA 151
R: CAAAGTAGAAAAGGGCAACC
cytochrome c F: AAAGGAGGCAAGCATAAGACTGG 104
R: CCTTTGTTCTTGTTGGCATCTGT
Caspase3 F: GGACCTGTGGACCTGAAAAA 159
R: GCATGCCATATCATCGTCAG