Skip to main content

Table 1 Primer pairs used in this study

From: Altered gene expression of VEGF, IGFs and H19 lncRNA and epigenetic profile of H19-DMR region in endometrial tissues of women with endometriosis

Genes Primer Sequences (5′–3′) Product length (bp)
A. Real-time RT-PCR primers   
 VEGF F: ACCCACCCACATACATAC 151
R: CAGCAGTCAAATACATCCAG
 IGF1 F: ATGCTCTTCAGTTCGTGTG 148
R: CAATACATCTCCAGCCTCCT
 IGF2 F: CCTCTATCCTTGATACAACAGC 121
R: AATTCGTCTGATTGTCCAGG
 H19 F: GTGACAAGCAGGACATGAC 121
R: GAAGTAAAGAAACAGACCCGC
 GAPDH F: CTCATTTCCTGGTATGACAACGA 122
  R: CTTCCTCTTGTGCTCTTGCT
B. Real-time ChIP PCR primers  
 H19-DMR F: CTACAACCAATTCCGTGCCA 127
R: TAGTGTGAAACCCTTCTCGC
 H19-DMR F: TATCTCAGCCAACACAAGGA 127
R: GCCAGACATTAACATTCCCA
  1. F and R are referred as forward and reverse primers respectively